View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3307_high_36 (Length: 227)
Name: NF3307_high_36
Description: NF3307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3307_high_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 4 - 139
Target Start/End: Original strand, 52671249 - 52671384
Alignment:
| Q |
4 |
tcataaacgattagatataaaatatatacatttttgcccaccgcatgtctatggtttgtagttaagagtacatttcttcatactcttatatgttgacgta |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52671249 |
tcataaacgattagatataaaatatatacatttttgcccaccgcatgtctatggtttgtagttaagagtacatttctgcatactcttatatgttgacgta |
52671348 |
T |
 |
| Q |
104 |
ccgaatgtactcaagccatttccatctctttgtagt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52671349 |
ccgaatgtactcaagccatttccatctctttgtagt |
52671384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 152 - 227
Target Start/End: Original strand, 52671461 - 52671536
Alignment:
| Q |
152 |
actacatgaaacaaattgatagtttatgtaaggtcaaaattaagaacttgtctacattatataagaatagaaaact |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52671461 |
actacatgaaacaaattgatagtttatgtaaggtcaaaattaagaacttgtctacattatataagaatagaaaact |
52671536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University