View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3307_low_26 (Length: 296)
Name: NF3307_low_26
Description: NF3307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3307_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 8004697 - 8004974
Alignment:
| Q |
1 |
acaaaagaatgctgggtcttattattaccttgatgactgagtttaacaatggaggtctgtctgggtaacaatggaggtctggacgatgatctgggtaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8004697 |
acaaaagaatgctgggtcttattattaccttgatgactgagtttaacaatggaggtctgtctgggtaacaatggaggtctggacgatgatctgggtaaca |
8004796 |
T |
|
| Q |
101 |
atggaggtatggctaacaatggaggtggttttgatggtttcaattttgatggagcttatgcagaatgattagta-nnnnnnnnaattcaccagatttact |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8004797 |
atggaggtatggctaacaatggaggtggttttgatggtttcaattttgatggagcttatgcagaatgattagtatttttttttaattcaccagatttact |
8004896 |
T |
|
| Q |
200 |
tttttggtcccatggtacatgttgggaatcttggtttagctttgtttttatgttctagaaacatggttaattactttg |
277 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8004897 |
tttttgctcccatggtacatgttgggaatcttggtttagctttgtttttatgttctagaaacatggttaattactttg |
8004974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 2 - 45
Target Start/End: Original strand, 51518991 - 51519034
Alignment:
| Q |
2 |
caaaagaatgctgggtcttattattaccttgatgactgagttta |
45 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
51518991 |
caaaagaatgctggctcttattattacctcgatgactgagttta |
51519034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University