View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3307_low_29 (Length: 276)
Name: NF3307_low_29
Description: NF3307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3307_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 127 - 259
Target Start/End: Original strand, 7861405 - 7861537
Alignment:
| Q |
127 |
ctcttctatgtttctttagtaagaaaataaattttccannnnnnngctcacatctattttaccatgttagcattgcaaatatatagctatttggtgtcca |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7861405 |
ctcttctatgtttctttagtaagaaaataaattttccattgttttgctcacatctattttaccatgttagcattgcaaatatataactatttggtgtcca |
7861504 |
T |
|
| Q |
227 |
ttccgttatgttttcaaaaagaaacaccaaata |
259 |
Q |
| |
|
|||| || ||||||||||||||||||||||||| |
|
|
| T |
7861505 |
ttccattgtgttttcaaaaagaaacaccaaata |
7861537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 50177017 - 50176973
Alignment:
| Q |
18 |
ttctgctcctgtttgaggcaaaggtggtgggtgcaatttttctgtt |
63 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50177017 |
ttctgctcctgtttgaggcaa-ggtggtgggtgcaatttttctgtt |
50176973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University