View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3307_low_33 (Length: 259)
Name: NF3307_low_33
Description: NF3307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3307_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 108 - 244
Target Start/End: Complemental strand, 38038130 - 38037994
Alignment:
| Q |
108 |
gtagccatgatcatagattaaggcacaaactttaatgttgaggcaactttgatgaaaagatgctgggcaactatcgcagcaaatcaactctcctccgtct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38038130 |
gtagccatgatcatagattaaggcacaaactttaatgttgagacaactttgatgaaaagctgctggacaactatcgcagcaaatcaactctcctccgtct |
38038031 |
T |
|
| Q |
208 |
ttacaaacaccacatgactcttcgttaaggtctttat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038030 |
ttacaaacaccacatgactcttcgttaaggtctttat |
38037994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University