View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3307_low_36 (Length: 237)
Name: NF3307_low_36
Description: NF3307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3307_low_36 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 54852364 - 54852583
Alignment:
| Q |
18 |
ggtatttgatctttgaggttcgaaattttgagttgcagctggggagcattgggagtttttgtcgagtattggctcatatcttagattattttgtggtatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54852364 |
ggtatttgatctttgaggttcgaaattttgagttgcagctggggagcattgggagtttttgtcgagtattggctcatatcttagattattttgtggtatt |
54852463 |
T |
 |
| Q |
118 |
ttttggaagtgccattccttcgtatcttggtcaggccaaatttcatatctttgggcagcttgagaggaagtataggactgagaatttatttcaaaagtgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54852464 |
ttttggaagtgccattccttcgtatcttagtcaggccaaatttcatatctttgggcagcttgagaggaagtataggactgagaatttatttcaaaagtgt |
54852563 |
T |
 |
| Q |
218 |
ggagcaatatacattcaagt |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
54852564 |
ggagcaatatacattcaagt |
54852583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University