View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3307_low_36 (Length: 237)

Name: NF3307_low_36
Description: NF3307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3307_low_36
NF3307_low_36
[»] chr3 (1 HSPs)
chr3 (18-237)||(54852364-54852583)


Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 54852364 - 54852583
Alignment:
18 ggtatttgatctttgaggttcgaaattttgagttgcagctggggagcattgggagtttttgtcgagtattggctcatatcttagattattttgtggtatt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54852364 ggtatttgatctttgaggttcgaaattttgagttgcagctggggagcattgggagtttttgtcgagtattggctcatatcttagattattttgtggtatt 54852463  T
118 ttttggaagtgccattccttcgtatcttggtcaggccaaatttcatatctttgggcagcttgagaggaagtataggactgagaatttatttcaaaagtgt 217  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54852464 ttttggaagtgccattccttcgtatcttagtcaggccaaatttcatatctttgggcagcttgagaggaagtataggactgagaatttatttcaaaagtgt 54852563  T
218 ggagcaatatacattcaagt 237  Q
    ||||||||||||||||||||    
54852564 ggagcaatatacattcaagt 54852583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University