View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3307_low_37 (Length: 236)
Name: NF3307_low_37
Description: NF3307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3307_low_37 |
 |  |
|
| [»] scaffold0472 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0472 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 2665 - 2444
Alignment:
| Q |
1 |
aaggagtttattataagactaaccactgtaaaaggggg-ctcactaaccaggtatgatcacttcacatcattccaattttatcactcatttacttatata |
99 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2665 |
aaggagcttattataagactaaccactgtaaaaggggggctcactaaccaggtatgatcacttcacatcattccaattttatcactcatttacttatata |
2566 |
T |
 |
| Q |
100 |
tcgagtgtgtcaactatttgctagcacctcgtctgactcaagcgttgcaatattttctgtagtcgtccctacactttgaagaaaagcataaagaggaact |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2565 |
tcgagtgtgtcaactatttgctagcacctcgtctgactcaagcgttgcaatattttctatagtcgtccctacactttgaagaaaagcataaagaggaaca |
2466 |
T |
 |
| Q |
200 |
tatgaccaatcatagagtattc |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2465 |
tatgaccaatcatagagtattc |
2444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University