View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3307_low_38 (Length: 235)
Name: NF3307_low_38
Description: NF3307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3307_low_38 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 52035729 - 52035962
Alignment:
| Q |
1 |
agcatctcatgtcatttttaactcgactcaacttgccgtatgagctatgatatacattgtcgggagagaacttattatctgtgaagcttctacaatatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035729 |
agcatctcatgtcatttttaactcgactcaacttgccgtatgagcgatgatatacattgtcgggagagaacttattatctgtgaagcttctacaatatta |
52035828 |
T |
 |
| Q |
101 |
gtatttgtcaacaaaataattcgaagtaattgacannnnnnnataggtgttcttgcaagttgtttggataattgatgaaaagaatgaatgaaaaatgtaa |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035829 |
gtatttgtaaacaaaataattcgaagtaattgata-ttttttatacgtgttcttgcaagttgtttggataattgatgaaaagaatgaatgaaaaatgtaa |
52035927 |
T |
 |
| Q |
201 |
gaggatggaattgataaaccactcaatagattaca |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035928 |
gaggatggaattgataaaccactcaatagattaca |
52035962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University