View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3308_high_28 (Length: 340)
Name: NF3308_high_28
Description: NF3308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3308_high_28 |
 | |
|
| [»] scaffold0088 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 2e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 45307027 - 45307173
Alignment:
| Q |
1 |
ccctctctctaatattgattgtgcatatctcatctccccactacataacatactgcactgtccataaaagccctaatcagtattgtcatttctgttctca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45307027 |
ccctctctctaatattgattgtgcatatctcatctccccactacataacatactgcactgtccataaaagccctaatcagtattgtcatttctgttctca |
45307126 |
T |
|
| Q |
101 |
ttgtcattgctagctaagctagctactagttgtcaaatatattattgctagg |
152 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45307127 |
ttgtcattgct-----agctagctactagttgtcaaatatattattgctagg |
45307173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 177 - 340
Target Start/End: Complemental strand, 46357 - 46191
Alignment:
| Q |
177 |
ataggtatcttatacttac---acaccaattctctactctcctcgtacgtagtaaagagaaaactgaactgctttatgaaatactatgttaagcagaggg |
273 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||| ||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46357 |
ataggtatcttatacttactacacaccaattatctgctctcctcgtatgtagcaaagagaaaactgaactgctttatgaaatactatgttaagcagaggt |
46258 |
T |
|
| Q |
274 |
agtaacctcgttatttataatcggaggtcacttacatttctaatgtattctaataccatattattta |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
46257 |
agtaacctcgttatttataatcggaggtcacttacatttctaatgtattataataccttattattta |
46191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University