View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3308_high_32 (Length: 300)
Name: NF3308_high_32
Description: NF3308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3308_high_32 |
 |  |
|
| [»] scaffold0280 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 14 - 265
Target Start/End: Original strand, 37800558 - 37800809
Alignment:
| Q |
14 |
agattgtgcatatttaggtaatgccatgtttgggattgcaaggaacgcgtcattatccctataagagggatttgatctctcacattgcaaacttgttttc |
113 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
37800558 |
agattgtgcatatttaggtgatgcaatgtttgggattgcaaggaacgcgtcattatccctataagagggattggatccctcacattgcaaacttgttttc |
37800657 |
T |
 |
| Q |
114 |
ctaacacacccacctgacttatcccccagattccattcagacaccgattttggctcaaaacctctcaaacaactacaataaggctttgagttttcattgc |
213 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||| | || |||| || | |
|
|
| T |
37800658 |
ctaacacatccacctgagttatcccccagattccattcagacactgactttggctcgaaacctctcaaacaactacaataaggcatggaattttgataac |
37800757 |
T |
 |
| Q |
214 |
agctcccaaatgcaccgcagaaagcataaacctcacattgtcctcttggctg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
37800758 |
agctcccaaatgcaccgcagaaagcataaacatcacattgtactcttggctg |
37800809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 20 - 272
Target Start/End: Complemental strand, 37765188 - 37764936
Alignment:
| Q |
20 |
tgcatatttaggtaatgccatgtttgggattgcaaggaacgcgtcattatccctataagagggatttgatctctcacattgcaaacttgttttcctaaca |
119 |
Q |
| |
|
||||| |||||| ||||||||||| ||||||||| ||||| ||| || ||| || |||| || || ||||| ||||| || |||||||| || | | |
|
|
| T |
37765188 |
tgcatgtttaggcaatgccatgttggggattgcacggaacctgtcctttaccccattagagtgaccagaactctcgcattgtaaccttgtttttctcaga |
37765089 |
T |
 |
| Q |
120 |
cacccacctgacttatcccccagattccattcagacaccgattttggctcaaaacctctcaaacaactacaataaggctttgagttttcattgcagctcc |
219 |
Q |
| |
|
||||| ||||| | |||| ||| || ||| |||||| || ||||||||| |||| ||||||||| ||||||| ||||||||||||||| | ||||||| |
|
|
| T |
37765088 |
cacccgcctgagtgatcctccaaatcccagtcagactgtgactttggctcataaccactcaaacaattacaatacggctttgagttttcagtacagctcc |
37764989 |
T |
 |
| Q |
220 |
caaatgcaccgcagaaagcataaacctcacattgtcctcttggctgtgcccaa |
272 |
Q |
| |
|
|||| | |||||| ||||||||| ||||||| ||| ||||||||| |||||| |
|
|
| T |
37764988 |
caaacgaaccgcataaagcataagcctcacaatgttgtcttggctgcgcccaa |
37764936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0280 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 195 - 272
Target Start/End: Complemental strand, 15207 - 15130
Alignment:
| Q |
195 |
ggctttgagttttcattgcagctcccaaatgcaccgcagaaagcataaacctcacattgtcctcttggctgtgcccaa |
272 |
Q |
| |
|
||||||||||| | ||| ||||| ||||||||||| |||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
15207 |
ggctttgagttctgattacagctaccaaatgcaccacagaaagcataaacctcacactgtcctcttggctgtgaccaa |
15130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 162 - 254
Target Start/End: Original strand, 6433426 - 6433518
Alignment:
| Q |
162 |
tttggctcaaaacctctcaaacaactacaataaggctttgagttttcattgcagctcccaaatgcaccgcagaaagcataaacctcacattgt |
254 |
Q |
| |
|
||||||||| |||| || |||||| ||||||| ||||| ||||| ||| ||||||||||||| | |||||| |||||||||| |||||||||| |
|
|
| T |
6433426 |
tttggctcacaaccactgaaacaattacaatatggcttcgagttctcagtgcagctcccaaacgaaccgcacaaagcataaatctcacattgt |
6433518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University