View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3308_high_36 (Length: 262)
Name: NF3308_high_36
Description: NF3308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3308_high_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 20 - 252
Target Start/End: Original strand, 41468160 - 41468392
Alignment:
| Q |
20 |
agtaacgagtccaaccaagttcagtgagtcgttgctcaagttgagagaaggaatgaatgacttggtttgttggaagatatacaagaattcttggtcttgc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41468160 |
agtaacgagtccaaccaagttcagtgagtcgttgctcaagttgagagaaggaatgaatgacttggtttgttggaagatatacaagaactcttggtcttgc |
41468259 |
T |
 |
| Q |
120 |
acctggtgctgttgctgttcctgttcctggttctgtcttgtgctcaaaggattctcttgttgggttggttattaacctcaccacacctttcttgtcaaat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41468260 |
acctggtgctgttgctgttcctgttcctggttctgtcttgtgctcgaaggattctcttgttgggttggttattaacctcaccacacctttcttgtcaaat |
41468359 |
T |
 |
| Q |
220 |
acccatacacctgacattacttgctttcctttg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41468360 |
acccatacacctgacattacttgctttcctttg |
41468392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University