View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3308_high_65 (Length: 234)
Name: NF3308_high_65
Description: NF3308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3308_high_65 |
 |  |
|
| [»] scaffold0009 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0009 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 76 - 219
Target Start/End: Original strand, 259670 - 259813
Alignment:
| Q |
76 |
gttggttttgtaaggttgatttgatacaactaaaattattatattgtattatagcttattcaagatccgttatcatctcacttctatcagtccacttggg |
175 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
259670 |
gttggttttgtaaggttgattagatacaactaaaattattatattgtaacatagcttattcaagatccgttatcatctcaccgctatcagtccacttggg |
259769 |
T |
 |
| Q |
176 |
ccacactaaaatttcatgtcttaagtaggatatggatgtgttaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
259770 |
ccacactaaaatttcatgtcttaagtaggatatggatgtgttaa |
259813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 34 - 75
Target Start/End: Original strand, 259575 - 259616
Alignment:
| Q |
34 |
ttataaagcaaagaaagttaaataggtgtatgtgttaagagt |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
259575 |
ttataaagcaaagaaagttaaataggtgtatgtgttaagagt |
259616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University