View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3308_high_74 (Length: 201)
Name: NF3308_high_74
Description: NF3308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3308_high_74 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 8e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 8e-63
Query Start/End: Original strand, 43 - 185
Target Start/End: Complemental strand, 52724398 - 52724254
Alignment:
| Q |
43 |
agacagcttgtgccagtaatatatata--agttttgggataagtgtctttttgtatgtgcctaaagagtaaacactagatttggtcgtgtgacctaagca |
140 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52724398 |
agacaacttgtgccagtaatatatatataagttttgggataagtgtctttttgtatgtgcctaaagagtaaacactagatttggtcgtgtgaccgaagca |
52724299 |
T |
|
| Q |
141 |
aagactaatcattcgaaatattaggatcaattttaacgggttcat |
185 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52724298 |
aagactaatcattcgaaatattatgatcaattttaacgggttcat |
52724254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University