View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3308_low_29 (Length: 383)
Name: NF3308_low_29
Description: NF3308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3308_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 15 - 367
Target Start/End: Complemental strand, 9662113 - 9661761
Alignment:
| Q |
15 |
tccttcacaaaacacgtttccaacaaaattcccctgtcccatacctccacaaacaaaactccaacctctctctgtattcatcttgtttgctacaaattcc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9662113 |
tccttcacaaaacacgtttccaacaaaattcccctgtcccatacctccacaaacaaaactccaacctctctctgtattcatcttgtttgctacaaattcc |
9662014 |
T |
 |
| Q |
115 |
attccaaaccttcaacaatgtccaacaacagcaacaacaacgcatgtgggttgatatcatgcgacaaacttgacagagttgccaactgggtcggcaccaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9662013 |
attccaaaccttcaacaatgtccaacaacagcaacaacaacgcatgtgggttgatatcatgcgacaaacttgacagagttgccaactgggtcggcaccaa |
9661914 |
T |
 |
| Q |
215 |
cgtggcttctgctttctttgcttccttggaacgttgttcttgcatcaaccttaccaccactgacattgaagatgataacaacaacgatgatcttcctctc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9661913 |
cgtggcttctgctttctttgcttccttggaacgttgttcttgcatcaaccttaccaccactgacattgaagatgataacaacaacgatgatcttcctctc |
9661814 |
T |
 |
| Q |
315 |
atggttactaagcctgtttctcatcttccttttgagggtcccaccacttctct |
367 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9661813 |
atggttactacccctgtttctcatcttccttttgagggtcccaccacttctct |
9661761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University