View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3308_low_36 (Length: 313)
Name: NF3308_low_36
Description: NF3308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3308_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 253
Target Start/End: Complemental strand, 23405468 - 23405228
Alignment:
| Q |
13 |
ccaacaacatatagctatgggaagtttttgctcacgacatgaaaagaaaagagattataataacacatacaagaacggtggaggatttaaggccatgcat |
112 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23405468 |
ccaacaacatatagctatgggaaacttttgctcacgacatggaaagaaaagagattataataacacatacaagaacggtggaggatttaaggccatgcat |
23405369 |
T |
|
| Q |
113 |
gcttctaaagctagcgccacaaaatatagaggtgatagcggtgccaaagatggtaacatgatttttatgactgctgctatagcaacgactcctgttgaca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23405368 |
gcttctaaagctagcgccacaaaatatagaggtgatagcggtgccaaagatggtaacatgatttttatgactgctgctatagcaacgactcctgttgaca |
23405269 |
T |
|
| Q |
213 |
caacttcagctggaaatcacggtcatcacggagacggaggg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23405268 |
caacttcagctggaaatcacggtcatcacggagacggaggg |
23405228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University