View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3308_low_44 (Length: 258)
Name: NF3308_low_44
Description: NF3308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3308_low_44 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 228; Significance: 1e-126; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 245
Target Start/End: Original strand, 176079 - 176306
Alignment:
| Q |
18 |
atacccgaagggaatgttggcaaatttgtaagtggcagcgttcattgggccattgaagatcaaaataaccgattcctaaaatcacaagatccagatgacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
176079 |
atacccgaagggaatgttggcaaatttgtaagtggcagcgttcattgggccattgaagatcaaaataaccgattcctaaaatcacaagatccagatgacc |
176178 |
T |
|
| Q |
118 |
actcttcatggtcatggcacattctttctcttcatttaggaaatgagtcgtatcgggagatttcccagcccgattatggtctacctctgcataacttcag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
176179 |
actcttcatggtcatggcacattctttctcttcatttaggaaatgagtcgtatcgggagatttcccagcccgattatggtctacctctgcataacttcag |
176278 |
T |
|
| Q |
218 |
cttgggggtttctagggattgcctatgc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
176279 |
cttgggggtttctagggattgcctatgc |
176306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 137 - 237
Target Start/End: Complemental strand, 1459734 - 1459628
Alignment:
| Q |
137 |
cattctttctcttcatttaggaaatgagtcgtatcgggagatttcccagcccgattatggtcta------cctctgcataacttcagcttgggggtttct |
230 |
Q |
| |
|
||||||||||||| |||||||||| ||||| |||| ||||||| ||||| |||||||| || |||||||||||||| ||||||||||||| | |
|
|
| T |
1459734 |
cattctttctcttgatttaggaaacgagtcttatcaagagattttgcagcctaattatggtttagatgaacctctgcataactttagcttgggggtttat |
1459635 |
T |
|
| Q |
231 |
agggatt |
237 |
Q |
| |
|
||||||| |
|
|
| T |
1459634 |
agggatt |
1459628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 137 - 237
Target Start/End: Complemental strand, 1471116 - 1471010
Alignment:
| Q |
137 |
cattctttctcttcatttaggaaatgagtcgtatcgggagatttcccagcccgattatggtcta------cctctgcataacttcagcttgggggtttct |
230 |
Q |
| |
|
||||||||||||| |||||||||| ||||| |||| ||||||| ||||| ||||||| | || ||||||| |||||| ||||||||||||||| |
|
|
| T |
1471116 |
cattctttctcttaatttaggaaacgagtcttatcaagagattttacagcctgattatgatttagatgaacctctgcgtaactttagcttgggggtttct |
1471017 |
T |
|
| Q |
231 |
agggatt |
237 |
Q |
| |
|
||||||| |
|
|
| T |
1471016 |
agggatt |
1471010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 199
Target Start/End: Original strand, 3926917 - 3926979
Alignment:
| Q |
137 |
cattctttctcttcatttaggaaatgagtcgtatcgggagatttcccagcccgattatggtct |
199 |
Q |
| |
|
||||||||||||| |||||||||| ||||| |||| |||||||| | |||||||| |||||| |
|
|
| T |
3926917 |
cattctttctcttgatttaggaaacgagtcctatcaagagatttcacggcccgattttggtct |
3926979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University