View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3308_low_45 (Length: 254)
Name: NF3308_low_45
Description: NF3308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3308_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 41 - 244
Target Start/End: Complemental strand, 38053698 - 38053499
Alignment:
| Q |
41 |
ccaaattgtagatatagcttggcttaggttctctttcttgttgcaattaaatatgctccaagacaaagattactttgtcacgttcaaagagcatttattc |
140 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38053698 |
ccaaattgtagatatagcttggcttagattctctttcttgttgcaattaaatatgctccaagacaaagtttactttgtcacgttcaaagagcatttattc |
38053599 |
T |
 |
| Q |
141 |
aaataaatcaattacgtgtgtaaatgataaatgaagttggtttgaagaactccactgactaaagatgatatgctaggtccatcatccttccctcgttctt |
240 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38053598 |
aaataaatcaattacgtgtgtagatgataaatgaagttggtttgaagaactcc----actaaagatgatatgctaggtccatcatccttccctcgttctt |
38053503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University