View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3308_low_51 (Length: 250)
Name: NF3308_low_51
Description: NF3308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3308_low_51 |
 |  |
|
| [»] scaffold0170 (2 HSPs) |
 |  |  |
|
| [»] scaffold0991 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0170 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 16 - 145
Target Start/End: Original strand, 7212 - 7341
Alignment:
| Q |
16 |
atggataaaaacagagaaaagtggtgaaagtttggggtatgacacaaccgaattaagtcgaaccgcatgcttttttatctcacggttaaaatgacttttt |
115 |
Q |
| |
|
|||| |||||||||||||||||||| ||| ||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7212 |
atgggtaaaaacagagaaaagtggtcaaaatttagggtatgacacaaccgaactaagtcgaaccgcatgcttttgtatctcacggttaaaatgacttttt |
7311 |
T |
 |
| Q |
116 |
tctcaaaaccgcaccgcgaacatccctact |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7312 |
tctcaaaaccgcaccgcgaacatccctact |
7341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0170; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 142 - 250
Target Start/End: Original strand, 7399 - 7507
Alignment:
| Q |
142 |
tactaacttgagcatcggagaacctacaggtacaccaccctcgtcgttccaaacattcaattagcatcaagcttgccacaccatacgtcgttcttctgat |
241 |
Q |
| |
|
|||| |||||||| ||| |||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
7399 |
tactgacttgagcgtcgaagaacctacaggtacaccaccctcatcgttaaaaacattcaattagcatcaagcttaccacaccagacgtcgttcttctgat |
7498 |
T |
 |
| Q |
242 |
cgaatcaga |
250 |
Q |
| |
|
||||||||| |
|
|
| T |
7499 |
cgaatcaga |
7507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 76 - 126
Target Start/End: Original strand, 24361556 - 24361606
Alignment:
| Q |
76 |
aaccgcatgcttttttatctcacggttaaaatgacttttttctcaaaaccg |
126 |
Q |
| |
|
|||| |||| ||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
24361556 |
aaccacatgtttttttatctcacggtttagatgacttttttctcaaaaccg |
24361606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 59
Target Start/End: Complemental strand, 13490236 - 13490193
Alignment:
| Q |
16 |
atggataaaaacagagaaaagtggtgaaagtttggggtatgaca |
59 |
Q |
| |
|
||||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
13490236 |
atggataaaaatagagaaaagtggtcaaaatttggggtatgaca |
13490193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 76 - 126
Target Start/End: Complemental strand, 42544679 - 42544628
Alignment:
| Q |
76 |
aaccgcatgcttttttatctcacggttaaaatgactttttt-ctcaaaaccg |
126 |
Q |
| |
|
||||||||||||||||||||| ||||| | ||||||||||| |||||||||| |
|
|
| T |
42544679 |
aaccgcatgcttttttatctcgcggtttagatgacttttttgctcaaaaccg |
42544628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 76 - 126
Target Start/End: Complemental strand, 9160999 - 9160950
Alignment:
| Q |
76 |
aaccgcatgcttttttatctcacggttaaaatgacttttttctcaaaaccg |
126 |
Q |
| |
|
||||||||||||||| ||||| ||||| |||||||||||||||||||||| |
|
|
| T |
9160999 |
aaccgcatgcttttt-atctcgcggtttgaatgacttttttctcaaaaccg |
9160950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 59
Target Start/End: Complemental strand, 17919242 - 17919199
Alignment:
| Q |
16 |
atggataaaaacagagaaaagtggtgaaagtttggggtatgaca |
59 |
Q |
| |
|
||||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
17919242 |
atggataaaaatagagaaaagtggtcaaaatttggggtatgaca |
17919199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 59
Target Start/End: Complemental strand, 21186790 - 21186747
Alignment:
| Q |
16 |
atggataaaaacagagaaaagtggtgaaagtttggggtatgaca |
59 |
Q |
| |
|
||||||||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
21186790 |
atggataaaaacagataaaagtggtcaaaatttggggtatgaca |
21186747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 60 - 113
Target Start/End: Complemental strand, 41325132 - 41325079
Alignment:
| Q |
60 |
caaccgaattaagtcgaaccgcatgcttttttatctcacggttaaaatgacttt |
113 |
Q |
| |
|
|||||||||||| || |||||||| ||| |||||||| ||||| |||||||||| |
|
|
| T |
41325132 |
caaccgaattaaatcaaaccgcatacttatttatctcgcggttcaaatgacttt |
41325079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0991 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0991
Description:
Target: scaffold0991; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 61
Target Start/End: Original strand, 400 - 440
Alignment:
| Q |
21 |
taaaaacagagaaaagtggtgaaagtttggggtatgacaca |
61 |
Q |
| |
|
|||||| ||||||||||||| ||| |||||||||||||||| |
|
|
| T |
400 |
taaaaatagagaaaagtggtcaaaatttggggtatgacaca |
440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 116
Target Start/End: Complemental strand, 29389053 - 29389013
Alignment:
| Q |
76 |
aaccgcatgcttttttatctcacggttaaaatgactttttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29389053 |
aaccgcatgcttttttatctcacggtttggatgactttttt |
29389013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University