View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3308_low_61 (Length: 240)
Name: NF3308_low_61
Description: NF3308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3308_low_61 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 16 - 240
Target Start/End: Complemental strand, 49534384 - 49534159
Alignment:
| Q |
16 |
caagccgaacattcacttgatcttctaatggtctagacagagagaaagaggacgg-ataccaagttttaattgcttttaggcatgaagaattggagattg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49534384 |
caagccgaacattcacttgatcttctaatggtctagacagagagaaagtggacggtataccaagttttaattgcttttaggcatgaagaattggagattg |
49534285 |
T |
|
| Q |
115 |
agaatgaagtatcttagtatgtatataatcctgtgggtgagtgatttaaatggctggacatatctattgaaataatattattcatagatattcttttcta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49534284 |
agaatgaagtatcttagtatgtatataatcctgtgggtgagtgatttaaatggctggacatatctattgaaataatattattcatagatattcttttcta |
49534185 |
T |
|
| Q |
215 |
attaacaattctctaatgcactttct |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
49534184 |
attaacaattctctaatgcactttct |
49534159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University