View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3308_low_80 (Length: 222)
Name: NF3308_low_80
Description: NF3308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3308_low_80 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 38768256 - 38768053
Alignment:
| Q |
1 |
attatggcttcttttgttaactcaggatttttatggtaaccagtgaaaacacttttgcctctgacacatatctccccacatggaggagttccaagaggat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
38768256 |
attatggcttcttttgttaactcaggattcttatggtaaccagtgaaaacacttttgcctctgacacatatctctccacatggcggagttccaagaggat |
38768157 |
T |
|
| Q |
101 |
tgtaacccatgtctggaacttcctccagccgcaattcattgaatacagttacaacaccaacattgcctagcatgcacatttcatctggaaatgtaagagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38768156 |
tgtaacccatgtctggaacttcctccagccgcaattcattgaatacagttacaacaccaacattacctagcatgcacatttcatctggaaatgtaagagt |
38768057 |
T |
|
| Q |
201 |
agtt |
204 |
Q |
| |
|
|||| |
|
|
| T |
38768056 |
agtt |
38768053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 3 - 204
Target Start/End: Original strand, 44995994 - 44996195
Alignment:
| Q |
3 |
tatggcttcttttgttaactcaggatttttatggtaaccagtgaaaacacttttgcctctgacacatatctccccacatggaggagttccaagaggattg |
102 |
Q |
| |
|
||||| ||| |||||||||||||| ||||| ||||| |||| |||||| ||| ||||| | ||||||||| ||||||| |||| |||||||||||||| |
|
|
| T |
44995994 |
tatggattcctttgttaactcagggtttttgtggtagccagagaaaactgatttccctctaagacatatctcaccacatgaaggatttccaagaggattg |
44996093 |
T |
|
| Q |
103 |
taacccatgtctggaacttcctccagccgcaattcattgaatacagttacaacaccaacattgcctagcatgcacatttcatctggaaatgtaagagtag |
202 |
Q |
| |
|
|||||||| ||||||||||| || || | | ||| ||| ||| || |||| |||||| | || ||||||||||||||||| ||||||| |||||||| |
|
|
| T |
44996094 |
taacccatctctggaacttcttctagttgtatttcgttgtatatagatacaggaccaacggtaccaagcatgcacatttcatcaggaaatgcaagagtag |
44996193 |
T |
|
| Q |
203 |
tt |
204 |
Q |
| |
|
|| |
|
|
| T |
44996194 |
tt |
44996195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University