View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3308_low_80 (Length: 222)

Name: NF3308_low_80
Description: NF3308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3308_low_80
NF3308_low_80
[»] chr1 (1 HSPs)
chr1 (1-204)||(38768053-38768256)
[»] chr7 (1 HSPs)
chr7 (3-204)||(44995994-44996195)


Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 38768256 - 38768053
Alignment:
1 attatggcttcttttgttaactcaggatttttatggtaaccagtgaaaacacttttgcctctgacacatatctccccacatggaggagttccaagaggat 100  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||    
38768256 attatggcttcttttgttaactcaggattcttatggtaaccagtgaaaacacttttgcctctgacacatatctctccacatggcggagttccaagaggat 38768157  T
101 tgtaacccatgtctggaacttcctccagccgcaattcattgaatacagttacaacaccaacattgcctagcatgcacatttcatctggaaatgtaagagt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
38768156 tgtaacccatgtctggaacttcctccagccgcaattcattgaatacagttacaacaccaacattacctagcatgcacatttcatctggaaatgtaagagt 38768057  T
201 agtt 204  Q
    ||||    
38768056 agtt 38768053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 3 - 204
Target Start/End: Original strand, 44995994 - 44996195
Alignment:
3 tatggcttcttttgttaactcaggatttttatggtaaccagtgaaaacacttttgcctctgacacatatctccccacatggaggagttccaagaggattg 102  Q
    ||||| ||| |||||||||||||| ||||| ||||| |||| ||||||   ||| ||||| | ||||||||| ||||||| |||| ||||||||||||||    
44995994 tatggattcctttgttaactcagggtttttgtggtagccagagaaaactgatttccctctaagacatatctcaccacatgaaggatttccaagaggattg 44996093  T
103 taacccatgtctggaacttcctccagccgcaattcattgaatacagttacaacaccaacattgcctagcatgcacatttcatctggaaatgtaagagtag 202  Q
    |||||||| ||||||||||| || ||  | | ||| ||| ||| || ||||  ||||||  | || ||||||||||||||||| ||||||| ||||||||    
44996094 taacccatctctggaacttcttctagttgtatttcgttgtatatagatacaggaccaacggtaccaagcatgcacatttcatcaggaaatgcaagagtag 44996193  T
203 tt 204  Q
    ||    
44996194 tt 44996195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University