View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3308_low_82 (Length: 216)
Name: NF3308_low_82
Description: NF3308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3308_low_82 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 11 - 202
Target Start/End: Original strand, 44372497 - 44372688
Alignment:
| Q |
11 |
acatcatcaccttctttttccacaacagttacttttcttgacttttcaacctcaaccaccttcttctcattctttaacaacccctgaagtttccaccttt |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44372497 |
acatcaccaccttctttttccacaacagttacttttcttgacttttcaacctcaaccacctttttctcattcttcaacaacccctgaagtttccaccttt |
44372596 |
T |
 |
| Q |
111 |
ctaattctgaactaggtttttgaggtggtttctctttaagggtcctcttagaatgcnnnnnnncactctctttttcatgatttggtgttagt |
202 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44372597 |
ccaattctgaactaggtttttgaggtggtttctctttaagggtcttcttagaatgcaaaaaaacactctctttttcatgatttggtgttagt |
44372688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University