View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3309_high_19 (Length: 246)
Name: NF3309_high_19
Description: NF3309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3309_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 230
Target Start/End: Original strand, 33829228 - 33829443
Alignment:
| Q |
15 |
atgaactatattagcattcaaattttaatcgtgaaaaagctcgactcaaatactatgaaactcgaaaaatacatgttttaacatgttgaatatatgcttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33829228 |
atgaactatattagcattcaaattttaatcgtgaaaaagctcgactcaaatactatgaaactcgaaaaatacatgttttaacttgttgaatatatgcttg |
33829327 |
T |
 |
| Q |
115 |
agatgagtataatcatacgacggtccaatatcaaaagattttttagacctgcataaattatgcagtttgattttccaactaattgaactaattaaaaata |
214 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33829328 |
agatgagcataatcttacgacggtccaatatcaaaagattttttagggctgcataaattatgcagtttgattttccaactaattgaactaattaaacata |
33829427 |
T |
 |
| Q |
215 |
tactactccaatcttg |
230 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
33829428 |
tactactccgatcttg |
33829443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University