View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3309_low_14 (Length: 368)
Name: NF3309_low_14
Description: NF3309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3309_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 9e-86; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 13 - 197
Target Start/End: Original strand, 15334445 - 15334629
Alignment:
| Q |
13 |
gaaggaggttcggtttcgggtttaaaggggaattcgggtgggcctttacccgggtattcgggtatattattactatttgagaaaagaggcgatgtaggga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15334445 |
gaaggaggttcggtttcgggtttaaaggggaattcgggtgggcctttacccgggtattcgggtatattattactatttgagaaaagagccgatgtaggga |
15334544 |
T |
|
| Q |
113 |
tagaaagtgatgatggaggttttttggaggataaatttgtgatgtagagaggtttggtgattgtgatggtggttttctttaggag |
197 |
Q |
| |
|
|| ||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
15334545 |
tacaaagtaatgatggaggttttttggaggataaatttgtggtgtagagaggtttggtaattgggatggtggttttctttaggag |
15334629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 294 - 352
Target Start/End: Original strand, 15334748 - 15334806
Alignment:
| Q |
294 |
atgtatggttgggatataagggattgaattgttgcatgatgaaaacacttgtaagctat |
352 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15334748 |
atgtatggtagggatacaagggattgaattgttgcatgatgaaaacacttgtaagctat |
15334806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 244 - 288
Target Start/End: Original strand, 15334673 - 15334718
Alignment:
| Q |
244 |
ttttgtgtaataatcatggagtagtaa-ttaagttgaaggtggtgg |
288 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
15334673 |
ttttgtgtaataatcatggagtagtaatttaagttgagggtggtgg |
15334718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University