View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3309_low_15 (Length: 339)
Name: NF3309_low_15
Description: NF3309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3309_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 298; Significance: 1e-167; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 9 - 318
Target Start/End: Complemental strand, 55075423 - 55075114
Alignment:
| Q |
9 |
gaagaatattttagaaaccacacaaaattactaatatcaattaaaattccaaacaacagaagactaatctagctggatagagtagaggttagcatcttca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55075423 |
gaagaatattttagaaaccacacaaaattactaatatcaattaaaatttcaaacaacagaagactaatctagctggatagagtagaggttagcatcttca |
55075324 |
T |
 |
| Q |
109 |
tgtgaagagaggatatcatgatatcacagggccctttatcttacaatgtgttgtcttgatgagaggatttgtggggagagataacatggactttcatgtg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
55075323 |
tgtgaagagaggatatcatgatatcacagggccctttatcttacaatgtgttgtcttgatgagatgatttgtggggagagataacatggactttcatgtg |
55075224 |
T |
 |
| Q |
209 |
ccaagtgaaaggttaagtcacaatcaactttaaagattatcccttgggttgaaaaacagaaaaatttggtggccttttccatctcttccaccaagcaatc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
55075223 |
ccaagtgaaaggttaagtcacaatcaactttaaagattatcccttgggttgaaaaacagaaaaatttgttggccttttccatctcttccaccaagcaatc |
55075124 |
T |
 |
| Q |
309 |
tcattcgcag |
318 |
Q |
| |
|
|||||||||| |
|
|
| T |
55075123 |
tcattcgcag |
55075114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 159 - 238
Target Start/End: Original strand, 50371212 - 50371291
Alignment:
| Q |
159 |
ttgtcttgatgagaggatttgtggggagaga-taacatggactttcatgtgccaagtgaaaggttaagtcacaatcaactt |
238 |
Q |
| |
|
|||||||||||||| || ||||||||||||| |||||||| ||||||||||||| |||||||| ||||||| |||||||| |
|
|
| T |
50371212 |
ttgtcttgatgagaagaattgtggggagagagtaacatggt-tttcatgtgccaaatgaaaggtaaagtcaccatcaactt |
50371291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University