View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3309_low_16 (Length: 321)
Name: NF3309_low_16
Description: NF3309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3309_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 73 - 240
Target Start/End: Original strand, 46599774 - 46599935
Alignment:
| Q |
73 |
gggggagggtactttccaggaaactaggcttttgtatagttggtgggtgtgggagggtctaactaaaactaaatacaatgactctgtagaatagattaga |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
46599774 |
gggggagggtactttccaggaaactaggcttttgtatagttggtgggtgtgg-agggtctaacttaaactaaatacaatgactctgtaga-----ttaga |
46599867 |
T |
 |
| Q |
173 |
tgcgatttgatatgcgtgtgtgtttattagagcaaccaacctttctggctggcacactctgatccagg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46599868 |
tgcgatttgatatgcgtgtgtgtttattagagcaaccaacctttctggctggcacactctgatccagg |
46599935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 43 - 73
Target Start/End: Original strand, 46599725 - 46599755
Alignment:
| Q |
43 |
tttgggtttgggagatattgttagggtgtgg |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46599725 |
tttgggtttgggagatattgttagggtgtgg |
46599755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University