View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3309_low_24 (Length: 242)
Name: NF3309_low_24
Description: NF3309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3309_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 226
Target Start/End: Complemental strand, 43621280 - 43621067
Alignment:
| Q |
13 |
tataaaaatatctcatattaaaacctgtcttaggccctaatacatgattagtcgacctgtataataaagtataaactttagtatttggatgtatataccc |
112 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43621280 |
tataaaaatgtctcatattaaaaccagtcttaggccctaatacatgattagtcgacctgtataataaagtataaactttagtatttggatgtatataccc |
43621181 |
T |
 |
| Q |
113 |
gaagaaagaaagaaggaaaatcttgcagaaggtcctcaaagacaatgggggtgcaagtttcctgcaccaaagaaatcaaatgaatgaagatatataaact |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43621180 |
gaagaaagaaagaaggaaaatcttgcagaaggtcctcaaagacaatgggggtgcaagtttcctgcaccaaagaaatcaaatgaatgaagatatataaact |
43621081 |
T |
 |
| Q |
213 |
attgatcaaccaag |
226 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43621080 |
attgatcaaccaag |
43621067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University