View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3310_high_11 (Length: 351)
Name: NF3310_high_11
Description: NF3310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3310_high_11 |
 |  |
|
| [»] scaffold0140 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0140 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 121 - 332
Target Start/End: Complemental strand, 16637 - 16426
Alignment:
| Q |
121 |
agtaattcgtctaaacttttttaaccatttttgagagaaatagcatacacacattggttgtcaaatgttgtggtcgtaaggcaacgacgactttaaagca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16637 |
agtaattcgtctaaacttttttaaccatttttgagagaaatagcatacacacattggttgtcaaatgttgtggtcgtgaggcaacgacgactttaaagca |
16538 |
T |
 |
| Q |
221 |
aatcattaagatcccctaccctatatagttaatatgaacacaagaagccgatatatgcaattaagtgcttgacccctctggacaaggcaacctttacatt |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16537 |
aatcattaagatcccctaccctatatagttaatatgaacacaagaagccgatatatgcaattaagtgcttgacccctctggacaaggcaacctttacatt |
16438 |
T |
 |
| Q |
321 |
gcacgtccttgc |
332 |
Q |
| |
|
|||||||||||| |
|
|
| T |
16437 |
gcacgtccttgc |
16426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 16754 - 16702
Alignment:
| Q |
1 |
tggtcgtcgtctaatagagatccagttcaaagatggatcatactatcttcagt |
53 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16754 |
tggtcgtcgtctaatagagatccaattcaaagatggatcatactatcttcagt |
16702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University