View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3310_high_22 (Length: 272)
Name: NF3310_high_22
Description: NF3310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3310_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 11 - 240
Target Start/End: Complemental strand, 46168368 - 46168138
Alignment:
| Q |
11 |
cacagatcaacagttccatcatgaaagtggttccttggtggaattggaattggaagctttctttgtggaagttgttacttggtaaag-aatcacttagtc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46168368 |
cacagatcaacagttccatcatgaaagtggttccttggtggaattggaattggaagctttctttgtggaagttgttacttggtaaaggaatcacttagtc |
46168269 |
T |
 |
| Q |
110 |
acacaatttaattattttaattgcatnnnnnnntagtcttaattacacttattgttcaaatatcgccgtagaatgtgattttgatcttctatttttatct |
209 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46168268 |
acacaatttaattattttaattgcataaaaaaatagtcttaattacacttattgttcaaatatcgccgtagaatgtgattttgatcttctatttttatct |
46168169 |
T |
 |
| Q |
210 |
acatgtttatcttcaattgcaattgtgtgtt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46168168 |
acatgtttatcttcaattgcaattgtgtgtt |
46168138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 46161546 - 46161505
Alignment:
| Q |
19 |
aacagttccatcatgaaagtggttccttggtggaattggaat |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46161546 |
aacagttccatcatgaaagtggttccttggtggaattggaat |
46161505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University