View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3310_high_34 (Length: 243)
Name: NF3310_high_34
Description: NF3310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3310_high_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 226
Target Start/End: Original strand, 39689029 - 39689241
Alignment:
| Q |
14 |
tgttggcatttttccaacaatacctatggttttaacggtcctaactaaaagggtgccatttagcctagaccatacttaagcttgtccatgattgattatt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
39689029 |
tgttggcatttttccaacaatacctatggttttaatggtcctaactaaaagggtgccatttagcatagaccatacttaaacttgtccatgattgattatt |
39689128 |
T |
 |
| Q |
114 |
ctacttttttaccattagatttagttccttttactctcaccaaatcctttccctcatctatgtttgcaacacaagtacacaaccgctcctacgcaggcca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39689129 |
ctacttttttaccattagatttagttccttttactctcaccaaatcctttccctcatctatgtttgcaacacaagtacacaaccgctcctacgcaggcca |
39689228 |
T |
 |
| Q |
214 |
gtaggtgggaagt |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39689229 |
gtaggtgggaagt |
39689241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University