View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3310_high_45 (Length: 233)
Name: NF3310_high_45
Description: NF3310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3310_high_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 11 - 215
Target Start/End: Complemental strand, 360160 - 359968
Alignment:
| Q |
11 |
tcgaagaatatatgtcggtaagatcaatattgtgttaaatatatgacattttcgtgtcgttgctcgaagcatatattattgacaataaattgagatatgt |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
360160 |
tcgaagcatatatgtcggtaagatcaatattgtgttaaatatatgacattttcgtgtcgttgctcgaagcatatattattgacaataaattgagttat-- |
360063 |
T |
|
| Q |
111 |
atgcatgtatatttaatttaatatgaaattttcatttctttacagttctagttggattggttgctgtaagcttcccattttttggaggcttgttagggtt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
360062 |
----------atttaatttaatatgaaattttcatttctttacagttctagttggattggttgctgtaagcttcccattttttggaggcttgttagggtt |
359973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University