View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3310_low_22 (Length: 274)
Name: NF3310_low_22
Description: NF3310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3310_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 16 - 266
Target Start/End: Complemental strand, 39688616 - 39688356
Alignment:
| Q |
16 |
tgaacttagttattttgaatgggaaatcct---gctaatccataagcaacggagtgatgtcaatgcaagaaacaacatgtggatgtgtcggtgcaagtat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39688616 |
tgaacttagttattttgaatgggaaatccttatgctaatccataagcaacggagtgatgtcaatgtaagaaacaacatgtggatgtgtcggtgcaagtat |
39688517 |
T |
 |
| Q |
113 |
atagcagatcaaaaagaggccaacta-------acaatgttggtgggttgggttgaattgagtgctcaatttcagtacttttatgtggggtgtgtaatac |
205 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39688516 |
atagaagatcaaaaagaggccaactagcaactaacaatgttggtgggttaggttgaattgagtgctcaatttcagtacttttatgtggggtgtgtaatac |
39688417 |
T |
 |
| Q |
206 |
agttatagtaagtggaagatacacttccgtgatgaacaaaaacatgatttttgtctgtgct |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39688416 |
agttatagtaagtggaagatacacttccgtgatgaacaaaaacatgatttttgtctgtgct |
39688356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University