View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3310_low_29 (Length: 251)
Name: NF3310_low_29
Description: NF3310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3310_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 13 - 230
Target Start/End: Complemental strand, 44380487 - 44380270
Alignment:
| Q |
13 |
aatatcatattatgagttggcagttgcatacatttattagaaagnnnnnnnnnnnnntagaaccaatatctcatagacagacacaaattatatatttgct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44380487 |
aatatcatattatgagttggcagttgcatatatttattagaaa-aaaattaataaaatagaaccaatatctcatagacagacacaaattatatatttgct |
44380389 |
T |
 |
| Q |
113 |
tnnnnnnn-gaaacaaattatatacacagtgtgtcacacactcacattataatttatgattccaggattctctcttttttgcttaatttcttcacaagtc |
211 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44380388 |
taaaaaaaagaaacaaattatatacacagtgtgtcacacactcacattataatttatgattccaggattctctcttttttgcttaatttcttcacaagtc |
44380289 |
T |
 |
| Q |
212 |
aaattttactactaccttg |
230 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44380288 |
aaattttactactaccttg |
44380270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University