View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3310_low_33 (Length: 245)
Name: NF3310_low_33
Description: NF3310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3310_low_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 7 - 232
Target Start/End: Original strand, 49545773 - 49545991
Alignment:
| Q |
7 |
agaagcaaagggtaaaaactaaaacgtcaggtgaagcttgtggagacaaggaaaaggtagcacattcatagaatggatcctgaagctactcctcttggct |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49545773 |
agaagcaaggggtaaaaactaaaacgtcaggtgaagcttgtggagacaaggaaaaggtagcacattcatagaatggatcctgaagctactcgtctt---- |
49545868 |
T |
|
| Q |
107 |
cttagtcaaaataatctgaaccgtctttaagagatatcttactattagcatcaattatggctggtgaattgtgatcacctgaatatttatttatactgtt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49545869 |
---agtcaaaataatctgaaccgtctttaagagatatcttactattagcatcaattatggctggtgaattgtgatcacctgaatatttatttatactgtt |
49545965 |
T |
|
| Q |
207 |
ctagatgaataactaaataagtagtg |
232 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
49545966 |
ctagatgaataactaaataagtagtg |
49545991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University