View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3310_low_45 (Length: 237)
Name: NF3310_low_45
Description: NF3310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3310_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 40 - 224
Target Start/End: Complemental strand, 49301638 - 49301454
Alignment:
| Q |
40 |
gcaacctcaacatcaatctgcatttgaccgtagttattcgcaatgttaaggattgcggtatgaccgcgattaaaatgatggcataccttcaaattggaat |
139 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49301638 |
gcaacctcgacatcaatctgcatttgaccgttgttattcgcaatgttaaggattgcggtatgaccgcgattaaaatgatggcataccttcaaattggaat |
49301539 |
T |
 |
| Q |
140 |
tcatgtattttgcttctttgtttaatttgatgattttttcgggagcatcttcttttattgcttgcttctcaataaaccaaggtgt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49301538 |
tcatgtattttgcttctttgtttaatttgatgattttttcgggagcatcttcttttattgcttgcttctcaataaaccaaggtgt |
49301454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University