View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3310_low_47 (Length: 222)

Name: NF3310_low_47
Description: NF3310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3310_low_47
NF3310_low_47
[»] chr4 (1 HSPs)
chr4 (1-220)||(6887497-6887716)


Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 6887716 - 6887497
Alignment:
1 tcttctatatcattccaaaacttgccacctactatggaatcaaaacccttttaaaaattggtaaagataatatgctttttgcaatttaataatcaattag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6887716 tcttctatatcattccaaaacttgccacctactatggaatcaaaacccttttaaaaattggtaaagataatatgctttttgcaatttaataatcaattag 6887617  T
101 agaatatgaattattccaacaaagactcacaggcgctgattacgcaaannnnnnnnnnnnncttgtgttttatgtgagaattatatgaaagctgaaaaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||             |||||||||||||||||||||||||||||||||||||||    
6887616 agaatatgaattattccaacaaagactcacaggcgctgattacgcaaattttttgttttttcttgtgttttatgtgagaattatatgaaagctgaaaaat 6887517  T
201 aaactactctttttgtttct 220  Q
    ||||||||||||||||||||    
6887516 aaactactctttttgtttct 6887497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University