View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3311_high_11 (Length: 237)
Name: NF3311_high_11
Description: NF3311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3311_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 109 - 220
Target Start/End: Complemental strand, 53091219 - 53091108
Alignment:
| Q |
109 |
tctcactaatcaagaacaaaggtaggataggttgcttgataacttggcaaccatgcagtagtccatattcaatcttgggagcaaaggaataacagattct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
53091219 |
tctcactaatcaagaacaaaggtaggataggttgcttgataacttggcaaccatgcagtggtgtatattcaatcttgggagcaaaggaataacagattct |
53091120 |
T |
 |
| Q |
209 |
atacattgagtt |
220 |
Q |
| |
|
|||||||||||| |
|
|
| T |
53091119 |
atacattgagtt |
53091108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University