View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3313_high_16 (Length: 236)
Name: NF3313_high_16
Description: NF3313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3313_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 28 - 220
Target Start/End: Complemental strand, 18946231 - 18946041
Alignment:
| Q |
28 |
atttgtaaattaaatatgtataaaatacaactgcattgaccatgacatcgaaactgtcataggtgcgtcaaagaaagnnnnnnnnnnnntaaacaattgg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| | ||||||| |
|
|
| T |
18946231 |
atttgtaaattaaatatgtataaaatacaattgcattgaccatgacatcaaaactgtcataggtgcgtcaaagaaaaagaaaaaaaaa--aggcaattgg |
18946134 |
T |
 |
| Q |
128 |
attcatagaagttatgctaaaataatggatagaaagtcatannnnnnnagtgtgcaaatgcaaatatgcacctattatttcggacaagttttg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18946133 |
tttcatagaagttatgctaaaataatggatagaaagtcatatttttttagtgtgcaaatgcaaatatgcacctattatttcggacaagatttg |
18946041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University