View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3313_low_13 (Length: 275)
Name: NF3313_low_13
Description: NF3313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3313_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 2 - 125
Target Start/End: Original strand, 11351105 - 11351228
Alignment:
| Q |
2 |
gggatggtttttcattgggtggggtggtttttaggggtcttttggatgggtagcgagcgatgggttttatggactttgttttttcagtggttgttttgca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11351105 |
gggatggtttttcattgggtggggtggtttttaggggtcttttggatgggtagcgagcgatgggttttatggactttgttttttcagtggttgttttgca |
11351204 |
T |
|
| Q |
102 |
actgggttttaatttaggcggtga |
125 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
11351205 |
actgggttttaatttaggcggtga |
11351228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 192 - 268
Target Start/End: Original strand, 11351289 - 11351365
Alignment:
| Q |
192 |
ctatttggggttttcttttagttgttccgcctatatacgacgcctttgtctagtaatttttggatgatcagtctctg |
268 |
Q |
| |
|
||||||||| |||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11351289 |
ctatttgggttttttttttagtcgttccgcctatatacgacgcctttgtctagtaatttttggatgatcagtctctg |
11351365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 2 - 125
Target Start/End: Complemental strand, 42638449 - 42638324
Alignment:
| Q |
2 |
gggatggtttttcattgggtggggtggtttttaggggtctttt-ggatgggtagcgagcgatgggt-tttatggactttgttttttcagtggttgttttg |
99 |
Q |
| |
|
||||||||||||| || ||| ||||||||||||||| | |||| ||||| |||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42638449 |
gggatggtttttctttaggttgggtggtttttagggttttttttggatgagtagcgagcgattggtgtttatggactttgttttttcagtggttgttttg |
42638350 |
T |
|
| Q |
100 |
caactgggttttaatttaggcggtga |
125 |
Q |
| |
|
|||||||||||||||||| ||||||| |
|
|
| T |
42638349 |
caactgggttttaatttacgcggtga |
42638324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 97
Target Start/End: Complemental strand, 36276036 - 36275949
Alignment:
| Q |
10 |
ttttcattgggtggggtggtttttaggggtcttttggatgggtagcgagcgatgggt-tttatggactttgttttttcagtggttgttt |
97 |
Q |
| |
|
||||| |||||| ||||||||||||| ||| ||||||||| |||| |||| |||||| |||||||| ||| |||||||||||| |||| |
|
|
| T |
36276036 |
ttttctttgggttgggtggtttttagaggttttttggatgagtagtgagcaatgggtgtttatgga-ttttatttttcagtggtcgttt |
36275949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 250
Target Start/End: Complemental strand, 42638253 - 42638195
Alignment:
| Q |
192 |
ctatttggggttttcttttagttgttccgcctatatacgacgcctttgtctagtaattt |
250 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||| | ||||||||| ||||||| |
|
|
| T |
42638253 |
ctatttgaagttttcttttaagtgttccgcctatatacggcacctttgtcttgtaattt |
42638195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 261
Target Start/End: Original strand, 2878030 - 2878083
Alignment:
| Q |
207 |
ttttagttgttccgcctatatacgacgcctttgtctagtaatttttggatgatca |
261 |
Q |
| |
|
|||||| |||||||||||||||| |||||||| | || ||||||||||||||||| |
|
|
| T |
2878030 |
ttttagatgttccgcctatatacaacgcctttattta-taatttttggatgatca |
2878083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 240
Target Start/End: Original strand, 5746984 - 5747017
Alignment:
| Q |
207 |
ttttagttgttccgcctatatacgacgcctttgt |
240 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
5746984 |
ttttaggtgttccgcctatatacgacgcctttgt |
5747017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 238
Target Start/End: Complemental strand, 34345869 - 34345833
Alignment:
| Q |
202 |
ttttcttttagttgttccgcctatatacgacgccttt |
238 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
34345869 |
ttttcctttaggtgttccgcctatatacgacgccttt |
34345833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University