View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3313_low_14 (Length: 256)
Name: NF3313_low_14
Description: NF3313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3313_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 241
Target Start/End: Complemental strand, 12034357 - 12034127
Alignment:
| Q |
11 |
atcatcaaagacattcaaagagaataatataattgaaagataactaaactattttagttaaaagttatatttgaaatttggatgattaaatactaactta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12034357 |
atcatcaaagacattcaaagagaataatagaattgaaagataactaaactattttagttaaatgttatatttgaaatttggatgattaaatgctaactta |
12034258 |
T |
 |
| Q |
111 |
tgcaatctaaggaagtatttacacatgagattatttttaatatagctagaaacccatttcaatttcaatgatctatattattgagtcttttatgttgttt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12034257 |
tgcaatctaaggaagtatttacacatgagattatttttaatatagctagaaacccatttaaattacaatgatctatattattgagtcttttatgttgttt |
12034158 |
T |
 |
| Q |
211 |
cactttttctttaaaacttctcattgtatct |
241 |
Q |
| |
|
|| |||||||||||||||||| ||||||||| |
|
|
| T |
12034157 |
cattttttctttaaaacttcttattgtatct |
12034127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University