View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3313_low_15 (Length: 250)
Name: NF3313_low_15
Description: NF3313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3313_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 11351613 - 11351853
Alignment:
| Q |
1 |
cccttttgtgcttaattactctaaattgctttctgtttcctacttgttgcagaggcaaatatgctatacttggaatcgcctgctggtgttggtttctcct |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11351613 |
cccttttatgcttaattactctaaattgctttctgtttcctacttgttgcagaggcaaatatgctatacttggaatcgcctgctggtgttggtttctcct |
11351712 |
T |
|
| Q |
101 |
attctacaaatgaatcattctacgactccgtgaatgattatttgacaggnnnnnnnaacttctttatgtgcaaaatagcatgtgaatggtaggtatcaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11351713 |
attctacaaatgaatcattctacgactccgtgaacgattatttgacaggtttttttaacttctttatgtgcaaaatagcatgtgaatggtagttatcaca |
11351812 |
T |
|
| Q |
201 |
agaagttgagttgaattattaacttctttttcgtttcattt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11351813 |
agaagttgagttgaattattaacttctttttcgtttcattt |
11351853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University