View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3313_low_19 (Length: 236)

Name: NF3313_low_19
Description: NF3313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3313_low_19
NF3313_low_19
[»] chr2 (1 HSPs)
chr2 (28-220)||(18946041-18946231)


Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 28 - 220
Target Start/End: Complemental strand, 18946231 - 18946041
Alignment:
28 atttgtaaattaaatatgtataaaatacaactgcattgaccatgacatcgaaactgtcataggtgcgtcaaagaaagnnnnnnnnnnnntaaacaattgg 127  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||              |  |||||||    
18946231 atttgtaaattaaatatgtataaaatacaattgcattgaccatgacatcaaaactgtcataggtgcgtcaaagaaaaagaaaaaaaaa--aggcaattgg 18946134  T
128 attcatagaagttatgctaaaataatggatagaaagtcatannnnnnnagtgtgcaaatgcaaatatgcacctattatttcggacaagttttg 220  Q
     ||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||| ||||    
18946133 tttcatagaagttatgctaaaataatggatagaaagtcatatttttttagtgtgcaaatgcaaatatgcacctattatttcggacaagatttg 18946041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University