View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3313_low_6 (Length: 409)
Name: NF3313_low_6
Description: NF3313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3313_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 20 - 406
Target Start/End: Complemental strand, 11616508 - 11616122
Alignment:
| Q |
20 |
gcaaccacaatttttagcaacttcttgagccaattcatacgatattttccctattccatcagagaaacagtatttgatttcgcctcttttcaattctata |
119 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
11616508 |
gcaaccacatttttcagcaacttcttgagccaattcatacgatattttccctattccatcagagaaacagtatttgattttgcctcgtttcaattctata |
11616409 |
T |
 |
| Q |
120 |
tcaggaatgatttcgatttcgtgtcttccaacactcactgtttcccttgaagagctgaatgattgaccaagccttgccgcatattttgccacgttcttga |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11616408 |
tcaggaatgatttcgatttcgtgtcttccaacactcactgtttcccttgaagaactgaatgattgaccaagccttgccgcgtattttgccacgttcttga |
11616309 |
T |
 |
| Q |
220 |
tttcatgaaaatctcccatccattttcttatatcacccgtggttagtccagttctcggtgcaaacatccacgctgagttatcgcgcaattggcttgacga |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11616308 |
tttcatgaaaatctcccatccattttcttatatcacccgtagttagtccagttctcggtgcaaacatccacgctgagttatcgcgcaattgacttgacga |
11616209 |
T |
 |
| Q |
320 |
gaaagcaagaaactcgaacttcttgtcaccgatttttatgccgttttttagtgtagacagtaccctttgatgaacctttgcttctcc |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11616208 |
gaaagcaagaaactcgaacttcttgtcaccgatttctatgccgttcgttagtgtagacagtaccctttgatgaacctttgattctcc |
11616122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University