View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3315_low_3 (Length: 323)
Name: NF3315_low_3
Description: NF3315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3315_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 7 - 103
Target Start/End: Complemental strand, 34567264 - 34567167
Alignment:
| Q |
7 |
ggagcacagaggataactaccaaatcactctacgtcatcataagtagcttgaagtatcatatattcatttgcaagc-agataaactttctgtcattct |
103 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34567264 |
ggagcacaaaggataactaccaaatcactctacgtcatcataagtagcttgaagtatcatatattcatttgcaagcaagataaactttctgtcattct |
34567167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 216 - 303
Target Start/End: Complemental strand, 34567000 - 34566913
Alignment:
| Q |
216 |
cgattcatattgaatttcttttcttttacgttgaattcaatttaaaaagaaagatcactttataaaaatataaaaaatccagtacatg |
303 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34567000 |
cgattcatattgaatttcttttcttttacattgaattcaatttaaaaagaaagatcactttataaaaatataaaaaatccagtacatg |
34566913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University