View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3315_low_6 (Length: 293)
Name: NF3315_low_6
Description: NF3315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3315_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 14 - 275
Target Start/End: Complemental strand, 1393615 - 1393353
Alignment:
| Q |
14 |
agaggaagccattgttctataattgagttgcacagctagtactgaaactagctatttatataatgttttgaaattggtttctgattaattataccaatgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1393615 |
agaggaagccattgttctataattgagttgcacagctagtactgaaactagctatttatataatgttttgaaattggtttctgattaattataccaatgg |
1393516 |
T |
|
| Q |
114 |
ttttggattgtgaaaatgataaacattccatattaaccacatgagattgg-nnnnnnnttgtatactggccttatcataatgcaccactatgtgaatgcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1393515 |
ttttggattgtgaaaatgataaacattccatattaaccacatgagattggaaaaaaaattgtatactggccttatcataatgcaccactatgtgaatgcc |
1393416 |
T |
|
| Q |
213 |
acgtggatgatgtcctactaatcttatcttcacttgtgaagaacataaatgtgtgacggttgt |
275 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1393415 |
acatggatgatgtcctactaatcttatcttcacttgtgaagaacataaatgtgtgatggttgt |
1393353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University