View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3315_low_8 (Length: 273)
Name: NF3315_low_8
Description: NF3315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3315_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 10 - 246
Target Start/End: Original strand, 31967371 - 31967595
Alignment:
| Q |
10 |
gcagagacattaggcaacgcacaacataacagcggtagatactggatacacgcatcccgaatagaatactctcactctcctccaccaaccacatttttat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31967371 |
gcagagacattaggcaacgcacaacataacagcggtagatactggatacacgaatcccgaata-------ctcactctcctccaccaaccacatttttat |
31967463 |
T |
 |
| Q |
110 |
atttcatttcatcattcaaaattataaaaacattctttactgtagtagtatacacattttcattttcattttattaattgatcgttgaaccaaagtccaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31967464 |
atttcatttcatcattcaaaattataaaaacattctttact-----agtatacacattttcattttcattttattaattgatcgttgaatcaaagtccaa |
31967558 |
T |
 |
| Q |
210 |
aacatttattacagatacacttcctttataactagct |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31967559 |
aacatttattacagatacacttcctttatagctagct |
31967595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University