View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3316_high_12 (Length: 231)
Name: NF3316_high_12
Description: NF3316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3316_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 15 - 196
Target Start/End: Original strand, 45768288 - 45768472
Alignment:
| Q |
15 |
aataacaacatattatgttcctcttaattaggtcaaaaatggattaccgatggaccaaaggtagcagcagcagta---agcatgattcttctggttcccg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45768288 |
aataacaacatattatgttcctcttaattaggtcaaaaatggattaccgatggaccaaaggtagcagcagcagtagtaagcatgattcttctggttcccg |
45768387 |
T |
 |
| Q |
112 |
gagaaaccaattcaaaaaggatcaggtaggtaattctatttatttactgttcattattaataaattgaaattgaaattgaaattg |
196 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45768388 |
gagaaaccaattcaaaaaggatcaggttggtaattctatttatttactgttcattattaataaattgaaattgaaattgaaattg |
45768472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University