View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3316_low_10 (Length: 259)
Name: NF3316_low_10
Description: NF3316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3316_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 10090529 - 10090307
Alignment:
| Q |
19 |
ttcttcaaccttgtgatgcttaggttagcaacatccttcttcacaacatactttgccacaatggatcagtggcttccatatgaaccagcaacagcgacag |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10090529 |
ttcttcaaccttgtgatgcttaggttaacaacatccttcttcacaatatactttgccacaatggatctgtggcttccatatgaaccagcaacagcgacaa |
10090430 |
T |
 |
| Q |
119 |
cctttgcagaaaaatgtcaataacagttactttaagcttaatcaattcttgaatgtcattagaaattaatgataacaatgagtgcaaaaacataatttac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10090429 |
cctttgcagaaaaatgtcaataacagttactttgagcttaatcaaatcttgaatgtcattagaaattaatgataacaatgagtgcaaaaacataatttac |
10090330 |
T |
 |
| Q |
219 |
cttgaggataatataccatgttc |
241 |
Q |
| |
|
||||||||||||| ||||||||| |
|
|
| T |
10090329 |
cttgaggataataaaccatgttc |
10090307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University