View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3316_low_3 (Length: 380)
Name: NF3316_low_3
Description: NF3316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3316_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 18 - 349
Target Start/End: Complemental strand, 44942225 - 44941913
Alignment:
| Q |
18 |
ggaactaatttgaatttcatcacaacagtttttggagtgttgtgttgtggggtagcatgcatagcactacactttcagaggtaacaataaggttactgag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44942225 |
ggaactaatttgaatttcatcacaacagtttttggagtgttgtgttgtggggtagcat----agcactacactttcagaggtaacaataaggttactgag |
44942130 |
T |
 |
| Q |
118 |
tgagtggtgaaaggtaaagtttgatttgaagaagcaaagcaaagcaaagcaaagaggaagaagatggaaatagaggatttggattatgttttggttcctg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44942129 |
tgagtggtgaaaggtaaagtttgatttgaagaagcaaag---------------aggaagaagatggaaatagaggatttggattatgttttggttcctg |
44942045 |
T |
 |
| Q |
218 |
ttggtatattgttgttgttaatttatcatgtttggcttctctacactataatccgacacccttctagcactgttattggcttgaatgctcagtctcgtta |
317 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44942044 |
ttggtatattggtgttgttaatttatcatgtttggcttctctacactataatccgacacccttctagcactgttattggcttgaatgctcagtctcgtta |
44941945 |
T |
 |
| Q |
318 |
ccagtggactcttttcatgatgtctgtcagta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44941944 |
ccagtggactcttttcatgatgtctgtcagta |
44941913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University