View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3316_low_5 (Length: 343)
Name: NF3316_low_5
Description: NF3316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3316_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 70 - 325
Target Start/End: Original strand, 38584185 - 38584440
Alignment:
| Q |
70 |
cctcaacaagtacttgatatggcaatgaaataatagtcaataaattttcttccctactatttttgggatgatgttgtgagataatattggtgattgtttg |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38584185 |
cctcaacaagtacttgatatggcaatgaaataatagtcaataaattttcttccctactatttttgggatgatgttgtgagataatattggtgattgtttg |
38584284 |
T |
 |
| Q |
170 |
gttcaagatttaaattataggtatgcattgacccatggcttctatgaaccgttgaggaaattcattggccatgtatataggccttcatcatccatcactt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38584285 |
gttcaagatttaaattataggtatgcattgacccatggcttctatgaaccgttgaggaaattcattggccatgtatataggccttcatcatccatcactt |
38584384 |
T |
 |
| Q |
270 |
tgattacaatttcatccgttcaattatttttagcaggtgtatatgagccggagact |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38584385 |
tgattacaatttcatccgttcaattatttttagcaggtgtatatgagccggagact |
38584440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University