View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3316_low_9 (Length: 279)
Name: NF3316_low_9
Description: NF3316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3316_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 115 - 243
Target Start/End: Original strand, 38611715 - 38611843
Alignment:
| Q |
115 |
aaatgttttgctaatatccctaattgaagatgaactgtttgaatctgatttagaactccttgatgtagacccgtgaatttgataagagctaaaacaacca |
214 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38611715 |
aaatgttttgctaatatccctaattgatgatgaactgtttgaatctgatttagaactccttgatgtagacccgtgaatttgataagagctaaaacaacca |
38611814 |
T |
 |
| Q |
215 |
cttcagtccttcacctcaaaatctagcgt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38611815 |
cttcagtccttcacctcaaaatctagcgt |
38611843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 119 - 183
Target Start/End: Original strand, 34722165 - 34722229
Alignment:
| Q |
119 |
gttttgctaatatccctaattgaagatgaactgtttgaatctgatttagaactccttgatgtaga |
183 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| ||||||||||||| ||||||| ||||||||| |
|
|
| T |
34722165 |
gttttgctaatatccctagttggtgatgaactgattgaatctgatttcgaactccctgatgtaga |
34722229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 20 - 56
Target Start/End: Original strand, 38611533 - 38611569
Alignment:
| Q |
20 |
aagaccacacaactttcaaacaggcagcatggcggac |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38611533 |
aagaccacacaactttcaaacaggcagcatggcggac |
38611569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 179
Target Start/End: Original strand, 34731457 - 34731519
Alignment:
| Q |
117 |
atgttttgctaatatccctaattgaagatgaactgtttgaatctgatttagaactccttgatg |
179 |
Q |
| |
|
||||||||||| ||| |||| || | |||||||| |||||| ||||||| ||||||||||||| |
|
|
| T |
34731457 |
atgttttgctattattcctatttaacgatgaactatttgaagctgattttgaactccttgatg |
34731519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University