View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3318_low_7 (Length: 259)
Name: NF3318_low_7
Description: NF3318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3318_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 92 - 240
Target Start/End: Original strand, 48766555 - 48766703
Alignment:
| Q |
92 |
gacatttccattggttcaactcctagcccctatgggacaatggggccatcatcatctacttgtgggggtcaagtgccataccaagcaccagaatcgtttc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48766555 |
gacatttccattggttcaactcctagcccctatggaacaatggggccatcatcatctacttgtgggggtcaagtgccataccaagcaccagaatcgtttc |
48766654 |
T |
 |
| Q |
192 |
aaaacataaaatcaaaccccaaatcggatgtgtattcatttggagttat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48766655 |
aaaacataaaatcaaaccccaaatcggatgtgtattcatttggagttat |
48766703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 48766479 - 48766544
Alignment:
| Q |
1 |
tctcttgaatgatatcaaccatagagggaatggttcatttagacatttagtgaaccagagaacccc |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48766479 |
tctcttgaatgatatcaaccatagagggaatggttcatttagacatttagtgaaccagagaacccc |
48766544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University